What is Programming in Computer Science
What is programming?
As we mentioned above, behind all the software we use every day there is a thorough development and testing process to be able to create and launch a program of any kind. This process is called programming, a task that many consider an art, and it is fundamental for the type of society in which we are immersed today. Programming in Computer Science what is computer science definition what is computer programming language basic computer languages
Basically, through programming we can establish step by step and through a certain code, the functions that a program will have and how the computer should process said code. For this, a programming language is used, which we will talk about later. What we do in language software after a certain process will become a computer program. what is computer science definition
INTERESTING: Who Invented The Telephone?
This programming must be guided by orders, instructions and expressions, which as a whole resemble a very basic language, for this reason the software we use to create programs is called a programming language.
This programming is carried out through the implementation of certain algorithms , which we will also talk about later, which for now we will basically explain as a set of specific rules that must be carried out step by step to achieve a certain objective. what is computer science definition
Computer science, as we have already expressed, occupies a place of great importance in modern society, and that is why we must learn, even minimally, what its characteristics are. This is basically for two reasons: The first of these reasons is to understand in greater depth the processes that are carried out in our devices, which would allow us to be able to solve all kinds of problems more easily, and also allow us to improve the way in how we reason logically. what is computer science definition
The second reason to learn programming is that computing can be a very important work environment, and programming can be a more than interesting job opportunity, mainly because programming is not a career that is for everyone , that is, they owe you Like numbers and structures, for this reason most of the time this area is restricted to those who are good in areas such as mathematics. what is computer science definition
In addition, there will always be the need for a programmer, both for large and small projects, which means that there will be very interesting job opportunities, which are very well paid.
What is programming for? Programming in Computer Science
Programming is basically about creating software using programs to create programs (IDEs), using a programming language , with the aim of meeting the computing needs of those who need to solve a problem or implement new features in an organization, company or even private clients. what is computer programming language
Learning to program software and do it well, is an art , since in addition to combining our skills with numbers and all kinds of mathematical operations, we must also use our creativity, intelligence and ingenuity to make our client find what he needs in the program that we are developing, and also feel comfortable doing so. what is computer programming language
Despite how easy or obvious it seems to understand what programming is or what programming is for, the truth is that many people are still not clear on either of the two concepts. To help understand what the scope of both ideas means, from this point on we will find information that will be very useful to understand these issues clearly. what is computer programming language
As we know, a computer is an incredibly powerful electronic device that can carry out all kinds of tasks. However, it is incapable of doing anything if it does not load and run a program, meaning that an unscheduled computer has the same knowledge value as a blender or other appliance. what is computer programming language
This means that all the hidden power in the hard drives, in the RAM memory or in the computer’s processor is waiting for a programmer to provide it with instructions to execute, which is done through a programming language. basic computer languages
Then it could be said that programming is defining certain instructions in a specific order to be executed by a computer and thus obtaining a certain result. With these loose instructions you create a set of behavior rules, called a program. In response to the question … What is programming for? The best answer we can give is “For everything”. what is computer programming language basic computer languages
Although the answer may seem a bit ambiguous, we have to take into account, and this is very relevant, that computers and electronic devices are used by billions of users around the world, that is, they are responsible for and assist us in many of the tasks we do every day, which would take a long time to list.
Electronic devices are everywhere; in industry, commerce, entertainment, culture, education and many other areas, and they are already part of human life to a point where it would be very difficult for us to detach ourselves from their functions. Without a doubt, a fertile field for well-prepared programmers.
Algorithms, programs and programming languages Programming in Computer Science
Many computer science or programming students think, especially early in their careers, that when it comes to sets of instructions, algorithms and programs are the same thing. what is computer programming language
However, an algorithm and a program are two quite different things. An algorithm could be exemplified as an idea to solve a problem expressed step by step, while a program performs a series of instructions that have been developed through an algorithm. what is computer programming language
In addition, a software program can only be executed by an electronic device such as a computer or telephone, since it is in binary language, while an algorithm, being expressed in a language understandable by humans, can be executed by a person. Those are the main differences. what is computer programming language
The algorithm, as we mentioned, is a set of instructions developed to solve a specific problem. Basically it is a concept that can be explained through our own language through flow diagrams , which are a graphic description of an algorithm using different figures and lines. basic computer languages
It is also possible to explain them through a technique in which it is necessary to indicate the input and output data and use cycle instructions and conditionals of the IF type, called pseudocode , basically a kind of interlocutor between our natural language and a language of programming. basic computer languages
In the case of programs, software or applications , as they are also called, it is always linked to execution by some type of electronic device, since being in binary code they can only be understood by the processors that these devices have to interpret and execute these instructions. basic computer languages
Algorithm example Programming in Computer Science
Algorithm to define if a triangle is scalene, isosceles or equilateral
Input data: side1, side2, side3
Output data: type
if side1 = side2 and side1 = side3
then
type <- equilateral
otherwise
if (side1 = side2) or (side1 = side3) or (side2 = side3)
then
type <- isosceles
otherwise
type <- scalene
Programming examples Programming in Computer Science
If we are taking the first steps in the world of programming , and we want to have all the possible information at hand to be as well prepared as we can, without a doubt one of the first things we have to start with is to know the different languages programming that exist in the market. basic computer languages
In this sense, from this point we will find the most used programming languages in the world , with which we can have an orientation about what we can do with them in order to know which is the one that best adapts to what we want to do.
Java Programming in Computer Science
There is no doubt that Java is one of the most popular programming languages. Launched by Sun Microsystems in 1995, it is one of the most widely used programming languages in all types of implementations, such as web design, games, mobile applications and control software for hundreds of thousands of devices, among others. basic computer languages
Java offers the advantages that it is a multiplatform programming language, it is open source and freely distributed, in addition to having a large library. As disadvantages for the user who is just beginning, we can mention its syntax, quite complex, and a certain slowness due to the fact that it has to be interpreted.
Java programming example
public class Class_name
{
public static void main (String args [])
{
// statement block;
}
}
JavaScript
JavaScript is a lightweight programming language, also multiplatform and structured, its development is of the “object-oriented” type. For these reasons JavaScript is one of the languages most used by website developers. As advantages we can say that JavaScript is safe and reliable, very complete in features and options, and others very simple to use, which is why it is very suitable for all those who are just starting out in the world of programming. However, it offers certain disadvantages such as certain vulnerabilities related to the visibility of its code, which can be read by anyone who is interested.
JavaScript programming example
<! DOCTYPE html>
<html>
<head>
<title> First program </title>
</head>
<body>
<script>
alert (“Open alert window”);
document.write (“Send content to HTML document”);
</script>
</body>
</html>
C ++
C ++ is an object manipulation programming language that was developed to extend the capabilities of another language, “C”. C ++ is known by developers as one of the best programming tools, mainly due to its flexibility and power.
This programming language is widely used in the development of operating systems, libraries and applications of all kinds. It also offers features such as the ability to compile the code we create on multiple platforms. As disadvantages we can mention that the use of libraries is complicated, as well as memory management, which must be taken care of by the developer. Likewise, it is not a language that can be useful to develop apps or web pages, nor to develop databases, so it is not the best option to start programming.
C ++ programming example
Circumference length = 2 * PI * Radius
Circumference Area = PI * Radius ^ 2
Volume of the sphere = (4/3) * PI * Radius ^ 3
#include <iostream>
#include <iomanip>
#include <cmath>
using namespace std;
int main (void)
{
const float PI = 3.1416;
float radius;
cout << “Enter the value of the radius:”;
cin >> radius;
cout << “\ nLength of circumference:” << fixed << setprecision (2) << 2 * PI * radius;
cout << “\ nArea of the circle:” << PI * pow (radius, 2);
cout << “\ nVolume of the sphere:” << (4.0 / 3) * PI * pow (radius, 3) << endl;
system (“pause”);
PHP
PHP is one of the most used programming languages for web development, very specifically oriented towards the development of dynamic web apps since it is possible to embed it in the HTML code. Its main characteristic is its simplicity of use, which makes it a programming language more than suitable for all those who are starting in the world of programming.
It is a very safe and reliable language, because its source code is hidden from both the browser that runs it and the client. But in addition to security, PHP is very flexible, which is why it can be used by both experienced programmers and students who are just starting out.
PHP programming example
<! DOCTYPE html>
<html>
<head>
<title> Example </title>
</head>
<body>
<? php
echo “Hi, I’m a PHP script!”;
?>
</body>
</html>
If you want to know more about PHP, you can get much more information at this link, which will take you directly to the official PHP site.
Perl
Without a doubt, next to JavaScript, Perl is one of the simplest programming languages that exist. Perl is used very assiduously for the development of CGI (Common Gateway Interface) applications, which is basically a technology that allows a web browser, in this case called a client, to request data from any process running on a web server. Some of the main characteristics of the Perl programming language are its extreme efficiency and very good performance. what is computer science definition
However, Perl should not necessarily be used solely in the web environment, as it can also be used for development in other environments. Some of the disadvantages of Perl are that it can be slow compared to other development tools, however this is because the code is compiled at the beginning of the run. Also its code can be difficult to read, and in many cases, it is very difficult to find and isolate errors to polish the program.
Perl programming example
#! / usr / bin / perl -w
# Storing DNA in a variable, and printing it out
# First we store the DNA in a variable called $ DNA
$ DNA = ‘ACGGGAGGACGGGAAAATTACTACGGCATTAGC’;
# Next, we print the DNA onto the screen
print $ DNA;
# Finally, we’ll specifically tell the program to exit.
exit;
Python
Python is an object-oriented programming language widely used to develop all kinds of applications and games for both the web and the desktop. It is multiplatform, freely distributed and really very flexible. what is computer science definition
Regarding the advantages of Python, we can mention that it integrates very well with other programming languages such as Java, C or C ++, among others. We could mention as disadvantages that there is not enough documentation, something very necessary and important especially for users who are just starting in the world of programming.
Python programming example
# Exercise 1
print (Juan)
print (‘Birthday: February 11)
age = 30
print (‘I am’, age, ‘years’)
actor = ‘Brad Pitt’
food = ‘Roast’
city = ‘Buenos Aires’
print (‘I like’ movies, actor)
print (‘I like dinner’, food)
print (‘I live in’, city)
